Insect Transmission of Plant Viruses

The fruit and seed morphology of 24 species, representing seven genera of Solanaceae were investigated by using a binocular stereomicroscope and scanning electron microscopy (SEM), to determine the significance of fruit and seed coat features as taxonomic characters. Morphological characters, including color, texture, shape, fruit type, hilum position, anticlinal shape and periclinal shape. There were three major patterns of seed ornamentation: irregular reticulate, regular reticulate and verrucate reticulate. The dendrogram showed that species could be grouped into two major clusters, the first cluster (I) contains 15 species and divided into two groups, while the second cluster (II) contains nine species that can be divided into two groups. The data proved useful in the construction of a dichotomous indented key to the studied species. Twenty characters were used to create systematic Key using DELTA key-generating programs. The results indicate that the morphological characteristics of fruits and seeds would be helpful for the identification of Solanaceae species.

The fruit and seed morphology of 24 species, representing seven genera of Solanaceae were investigated by using a binocular stereomicroscope and scanning electron microscopy (SEM), to determine the significance of fruit and seed coat features as taxonomic characters. Morphological characters, including color, texture, shape, fruit type, hilum position, anticlinal shape and periclinal shape. There were three major patterns of seed ornamentation: irregular reticulate, regular reticulate and verrucate reticulate. The dendrogram showed that species could be grouped into two major clusters, the first cluster (I) contains 15 species and divided into two groups, while the second cluster (II) contains nine species that can be divided into two groups. The data proved useful in the construction of a dichotomous indented key to the studied species. Twenty characters were used to create systematic Key using DELTA key-generating programs. The results indicate that the morphological characteristics of fruits and seeds would be helpful for the identification of Solanaceae species.

The pollen morphology and seed protein electrophoresis of 24 species, representing seven genera of Solanaceae were studied to determine the significance as taxonomic characters. Pollen morphological characters: including type, size, shape and ornamentation were investigated by using light and scanning electron microscopy (SEM). The pollen differed in type, size and shape and also seven types of ornamentation were recorded in the different species in this study. The storage seed protein was determined by using gel electrophoresis. The number of protein bands was detected with different molecular weights and ranged from 25 KDa to 77 KDa. The results of the two criteria were represented in the dendrogram which showed that species grouped into two major clusters, the first cluster (I) contains 12 species, while the second cluster (II) comprises 12 species and which can be divided into two groups. The results indicate that the morphological characteristics of pollen morphology and seed p...

Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV- and CtRLVaRNA to disease-free chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses.

Citrus tristeza virus (CTV) is a member of genus Closterovirus with long flexuous virions, approximately 2000 X 11 nm and monopartite genome and is vectored by aphids. CTV spreads into new regions via movement of infected propagating materials and within a citrus growing area by aphid dispersion. Efficiency of CTV transmissibility is affected by the species of aphids, the source plant at acquisition feeding and the CTV isolate. The BrCA is the most efficient aphid vector of CTV. In areas where BrCA is not present, Aphis gossypii is the most efficient vector implicated. In major citrus growing areas of Peninsular Malaysia, all Citrus varieties and its hybrides including Fortunella sp., Citrofortunella microcarpa and Citromelo were infected with CTV in a high rate. Survey of CTV vector (s) in Peninsular Malaysia revealed that at least there is one efficient vector (A. gossypii) of CTV in citrus growing areas.

Chaque annee, Agroscope controle l’absence de virus dans pres de 300 000 tubercules pour la certification des plants de pomme de terre destines aux producteurs suisses. Depuis 2016, ce controle est realise par PCR en temps reel, ou real time RT-PCR, directement apres la recolte, sur des tubercules dormants. Cette evolution permet d’obtenir des resultats plus rapidement et dispense de l’utilisation de traitements chimiques toxiques et polluants utilises pour lever la dormance. La nouvelle chaine analytique developpee par Agroscope a ete validee pendant trois ans sur des dizaines de lots et pres de 15 000 tubercules. Elle offre la possibilite de controler la bonne realisation de chaque etape de l’analyse et peut facilement s’adapter a la detection d’autres types de microorganismes susceptibles d’affecter la qualite des plants de pomme de terre

The fruit and seed morphology of 24 species, representing seven genera of Solanaceae were investigated by using a binocular stereomicroscope and scanning electron microscopy (SEM), to determine the significance of fruit and seed coat features as taxonomic characters. Morphological characters, including color, texture, shape, fruit type, hilum position, anticlinal shape and periclinal shape. There were three major patterns of seed ornamentation: irregular reticulate, regular reticulate and verrucate reticulate. The dendrogram showed that species could be grouped into two major clusters, the first cluster (I) contains 15 species and divided into two groups, while the second cluster (II) contains nine species that can be divided into two groups. The data proved useful in the construction of a dichotomous indented key to the studied species. Twenty characters were used to create systematic Key using DELTA key-generating programs. The results indicate that the morphological characteristics of fruits and seeds would be helpful for the identification of Solanaceae species.

Tomato (Lycopersicon esculentum Mill.) fruit, 'Santa Clara', were harvested at the breaker stage from commercial fields in Brazlandia, DF (Brazil) to investigate the ability of 1- methylcyclopropene (1-MCP) to retard tomato fruit ripening. Fruit without external blemishes were graded for size and di ameter, placed inside hermetically sealed boxes, and 1-MCP was applied for 12-hours (22 ± 1 °C; 80-85% RH) at four different concentrations: 0 (control), 250, 500 or 1000 ppb. Fruit were held at ambient conditions (23 ± 2°C; 80-85% RH) for 2 days and then stored inside a cold room (20 ± 1°C; 85-95% RH). Every 3 days during a 15-day period, fruit were analyzed for firmness, total soluble solids, titratable acidity, external color, and total carotenoids. Fruit treated with 1-MCP at 1000 ppp had a firmness about 88% higher than control fruit after 17 days. The a7b* ratio, an indicator of skin color, for fruit treated with 1- MCP at 1000 ppb was 38% lower than control fruit at the en...

Surveys during five consecutive years in four main seed potatogrowing areas of Tunisia revealed large differences in Potato virus Y (PVY) incidence. Infection rates at harvest ranged from up to 19% in Cap Bon and in Jendouba, to 31% in Kairouan and 48% in Manouba. However, infection rates were very low across the country in 2003 (1-5%), except in Kairouan, and rather low in 2004 (4-10%). Secondary infections in plants growing from imported seed potatoes were assessed to be 1-6% depending on region and year. Serological analysis of a first set of 90 samples collected in 2004-2005 revealed dominance of the PVY N group (90% of the total number of PVY positives). A second set of 44 isolates from samples collected in 2006 was further analyzed with a combination of serotyping, indexing on tobacco, and RT-PCR tests targeting four genomic regions (5′Ntr/P1, HcPro/P3, CI/NIa, CP). Thirty-five of these 44 isolates were typical PVY NTN isolates, with three recombination junctions in HcPro/P3, CI/NIa, and CP regions, respectively, whereas no recombination junction was identified in the genome of five isolates belonging to the PVY N group. One additional recombinant PVY NTN isolate was recovered from a mixed infection with a PVY O isolate. Only three PVY O isolates were recovered from the samples analyzed.

The fruit and seed morphology of 24 species, representing seven genera of Solanaceae were investigated by using a binocular stereomicroscope and scanning electron microscopy (SEM), to determine the significance of fruit and seed coat features as taxonomic characters. Morphological characters, including color, texture, shape, fruit type, hilum position, anticlinal shape and periclinal shape. There were three major patterns of seed ornamentation: irregular reticulate, regular reticulate and verrucate reticulate. The dendrogram showed that species could be grouped into two major clusters, the first cluster (I) contains 15 species and divided into two groups, while the second cluster (II) contains nine species that can be divided into two groups. The data proved useful in the construction of a dichotomous indented key to the studied species. Twenty characters were used to create systematic Key using DELTA key-generating programs. The results indicate that the morphological characteristics of fruits and seeds would be helpful for the identification of Solanaceae species.

Citrus tristeza virus (CTV) is a member of genus Closterovirus with long flexuous virions, approximately 2000 X 11 nm and monopartite genome and is vectored by aphids. CTV spreads into new regions via movement of infected propagating materials and within a citrus growing area by aphid dispersion. Efficiency of CTV transmissibility is affected by the species of aphids, the source plant at acquisition feeding and the CTV isolate. The BrCA is the most efficient aphid vector of CTV. In areas where BrCA is not present, Aphis gossypii is the most efficient vector implicated. In major citrus growing areas of Peninsular Malaysia, all Citrus varieties and its hybrides including Fortunella sp., Citrofortunella microcarpa and Citromelo were infected with CTV in a high rate. Survey of CTV vector (s) in Peninsular Malaysia revealed that at least there is one efficient vector (A. gossypii) of CTV in citrus growing areas.

Test tube plantlets were used to assess the transmission efficiency of Potato virus Y (PVY) from and to potato plants by the potato colonizing species green peach aphid (Myzus persicae) and the non-potato colonizing species soybean aphid (Aphis glycines). Similar levels of transmission of PVY by M. persicae were observed in the test tube plantlets and potted plants, demonstrating the reliability of this test for PVY transmission efficiency assay for aphids. The assay was then used to assess the transmission of PVYO and PVYN:O by M. persicae and A. glycines with two virus acquisition regimes, one with 5-min continuous probing and the other with 1-h acquisition access. The M. persicae mediated-transmission rate was 24.1% and 51.7% for PVYO and PVYN:O, respectively, under the 5-min acquisition regime; under the same acquisition regime, A. glycines led to 0.0% and 1.7% infection rates for PVYO and PVYN:O, respectively. Under the 1-h acquisition regime, no infection was observed except f...

Des études sur l’abondance et la diversité des pucerons ont été menées pendant trois campagnes agricoles au Mali. Sur la base de relevés de bacs jaunes installés dans des cultures de pomme de terre à Kati et à Sikasso, 2 525 pucerons ont été capturés et identifiés. Dix-neuf espèces de pucerons ont été recensées, dont deux qui ont été observées in situ sur la culture : Aphis gossypii (Glover) et Myzus persicae (Sulzer). La plupart de ces espèces sont des ravageurs de cultures et elles contribuent également à la transmission virale. Des échantillons foliaires prélevés dans des parcelles de pomme de terre dans les deux régions ont été testés par la technique ELISA pour la détection des deux principaux virus dommageables, soit le Potato Virus Y (PVY) et le Potato Leaf Roll Virus (PLRV). Le taux de plantes virosées dans les deux localités pendant les trois années variait de 19,3 % à 21,8 % pour le PVY, alors qu’il était de 8,5 % à 9,3 % pour le PLRV. L’occurrence de ces maladies virales ...

Citrus tristeza virus (CTV) is a member of genus Closterovirus with long flexuous virions, approximately 2000 X 11 nm and monopartite genome and is vectored by aphids. CTV spreads into new regions via movement of infected propagating materials and within a citrus growing area by aphid dispersion. Efficiency of CTV transmissibility is affected by the species of aphids, the source plant at acquisition feeding and the CTV isolate. The BrCA is the most efficient aphid vector of CTV. In areas where BrCA is not present, Aphis gossypii is the most efficient vector implicated. In major citrus growing areas of Peninsular Malaysia, all Citrus varieties and its hybrides including Fortunella sp., Citrofortunella microcarpa and Citromelo were infected with CTV in a high rate. Survey of CTV vector (s) in Peninsular Malaysia revealed that at least there is one efficient vector (A. gossypii) of CTV in citrus growing areas.

Citrus tristeza virus (CTV) is a member of genus Closterovirus with long flexuous virions, approximately 2000 X 11 nm and monopartite genome and is vectored by aphids. CTV spreads into new regions via movement of infected propagating materials and within a citrus growing area by aphid dispersion. Efficiency of CTV transmissibility is affected by the species of aphids, the source plant at acquisition feeding and the CTV isolate. The BrCA is the most efficient aphid vector of CTV. In areas where BrCA is not present, Aphis gossypii is the most efficient vector implicated. In major citrus growing areas of Peninsular Malaysia, all Citrus varieties and its hybrides including Fortunella sp., Citrofortunella microcarpa and Citromelo were infected with CTV in a high rate. Survey of CTV vector (s) in Peninsular Malaysia revealed that at least there is one efficient vector (A. gossypii) of CTV in citrus growing areas.

Asparagus (Asparagus officinalis L.) is a spring vegetable and a perennial flowering
plant of the family Liliaceae. Asparagus is native to Mesopotamia, East Mediterranean
area, but it is now a widely cultivated vegetable crop in temperate and tropical
regions. So far, nine viruses have been reported on asparagus, and for three of them,
Asparagus virus 1 (AV-1), Asparagus virus 2 (AV-2), and Asparagus virus 3 (AV-3),
asparagus is the only natural host (Tomassoli et al. 2012). AV-1, a member of the
genus Potyvirus, cause no distinct symptoms in plants of asparagus, which was initially
reported by Hein (1960).

A survey and indexing studies was carried out on weeds plants growing around potato fields to identify their role as an inoculum source for Potato leafroll virus (PLRV). Symptomatic and asymptomatic foliage samples of 26 weed species were collected and tested by DAS-ELISA and RT-PCR. Out of 783 samples tested, 132 samples showed positive reaction with PLRV antisera. RT-PCR was performed on ELISA positive samples to confirm the results. 110 samples showed amplification of desired band revealing PLRV infection. Weed plants tested positive for PLRV in indexing studies were Amaranthus viridis (4), Chenopodium album (19), Datura stramonium (10), Physalis minima (10), Solanum nigrum (56) and Withania somnifera (12). Results of the study indicated that among the six susceptible weed host plants detected, two weed species (C. album and S. nigrum) were abundantly growing and acting as important host plants and source of PLRV inoculum in potato growing regions of the present study. These weeds were found growing frequently in vacant fields and wastelands along roadsides and railway tracks near potato growing regions. Colonies of green peach aphids responsible for transmission of virus were observed on host plants infected with virus. Eradication of weed host plants from unused/waste lands bordering potato fields would be helpful in effective management of PLRV infection in potato.

A survey and indexing studies was carried out on weeds plants growing around potato fields to identify their role as an inoculum source for Potato leafroll virus (PLRV). Symptomatic and asymptomatic foliage samples of 26 weed species were collected and tested by DAS-ELISA and RT-PCR. Out of 783 samples tested, 132 samples showed positive reaction with PLRV antisera. RT-PCR was performed on ELISA positive samples to confirm the results. 110 samples showed amplification of desired band revealing PLRV infection. Weed plants tested positive for PLRV in indexing studies were Amaranthus viridis (4), Chenopodium album (19), Datura stramonium (10), Physalis minima (10), Solanum nigrum (56) and Withania somnifera (12). Results of the study indicated that among the six susceptible weed host plants detected, two weed species (C. album and S. nigrum) were abundantly growing and acting as important host plants and source of PLRV inoculum in potato growing regions of the present study. These weeds were found growing frequently in vacant fields and wastelands along roadsides and railway tracks near potato growing regions. Colonies of green peach aphids responsible for transmission of virus were observed on host plants infected with virus. Eradication of weed host plants from unused/waste lands bordering potato fields would be helpful in effective management of PLRV infection in potato.

Citation Open Access. Celery (Apium graveolens L.) is widely cultivated in most parts of China as an important and high-value cash crop. In June 2013, irregular chlorotic blotches, necrotic flecks, concentric ring spots, and shrinking symptoms were observed on leaves of celery plants in fields of Tonghai County, Yunnan Province of China. The disease incidences ranged from 5 to 20% in the field. Leaf samples were initially collected from 12 symptomatic plants and tested by dot ELISA with antisera against Cucumber mosaic virus, Tobacco mosaic virus, Tomato spotted wilt virus (TSWV), and Turnip mosaic virus (kindly provided by Xueping Zhou of Zhejiang University, China). Eight of these samples reacted positively with the TSWV antibody. For further confirmation of TSWV infection, total nucleic acids were extracted from the same 12 samples using a CTAB method (Li et al. 2008) and were used as templates in reverse-transcription (RT)-PCR. A pair of TSWV-specific primers, TSWVF (TCACTGTAATGTTCCATAGCAA) and TSWVR (AGAGCAATYGTGTCAATTTTATTC) described by Yin et al. (2013), were used to amplify a portion of the S RNA segment of TSWV in RT-PCR. Amplicons of approximately 800 bp were obtained from the eight ELISA-positive samples. Two of the amplicons, YTHa-QC4 and YTHa-QC8, were purified with Universal DNA Purification Kit (TIANGEN Biotech Co.) and directly sequenced. An NCBI BLAST search of the obtained sequences (Accessions Nos. KP034959 and KP034960) revealed that the two isolates shared the highest nucleotide sequence identity of 95 to 99% with those of other TSWV isolates available in GenBank. Both of the YTHa-QC4 and YTHa-QC8 isolates were most closely related to three TSWV Chinese isolates, two from tomato (HQ402595 and JF960235) and one from lettuce (JN664252), and to one Korean isolate from pepper (KC261949). Sap of the TSWV-positive celery plants were mechanically inoculated on 15 healthy celery plants. All inoculated plants produced chlorotic blotches, and some of them showed concentric ring spot symptoms. The TSWV infection of the inoculated plants was further confirmed by RT-PCR and sequential sequencing.

Citation Open Access. Cowpea (Vigna unguiculata) is widely cultivated in China as vegetable crops, with at least 0.33 million ha (10% of vegetables planted) annually. Over 140 viruses have been reported infecting cowpea (Aliyu and Balogun 2011). In July 2014, cowpea leaves showing mottling, shrinking, chlorosis, necrotic concentric rings, and yellow vein were observed in fields in Dali and Dehong autonomous prefectures, Yunnan Province, China. The disease incidence based on symptom observation was 1 to 3%. Leaf samples were initially collected from 12 diseased plants and tested by dot-enzyme linked immunosorbent assay (dot-ELISA) using six antisera of Cucumber mosaic virus, Tobacco mosaic virus, Cucumber green mottle mosaic virus, Turnip mosaic virus, Broad bean wilt virus 2, and Tomato spotted wilt virus (TSWV) (kindly provided by Dr. Xueping Zhou of Zhejiang University, China), respectively. Two of the samples reacted positively with TSWV antibody but none of the 12 samples reacted with the antisera for the other 5 viruses. Total nucleotide acids were then extracted from these samples using a CTAB-based method (Li et al. 2008) and used as templates in reverse-transcription (RT)-PCR with TSWV-specific primer pair of TSWVF (TCACTGTAATGTTCCATAGCAA) and TSWVR (AGAGCAATYGTGTCAATTTTATTC) (Yin et al. 2013). An amplicon of expected size (815 bp) was obtained from the diseased samples. The amplicon of a selected isolate, YDL-JD3, was cloned and sequenced. BLAST search of the obtained sequence (GenBank Accession No. KR259539) revealed that this isolate had the highest nucleotide sequence identity of 100% with the segment S of a TSWV tomato isolate from China (HQ402595), confirming the serological result. To confirm TSWV as causal agent of the observed disease, plant saps of isolate YDL-JD3 were mechanically inoculated onto healthy cowpea seedlings. Foliage shrinking was observed on the inoculated plants 10 days past inoculation (dpi), and more typical symptoms such as chlorosis and concentric spots were observed at 20 dpi. The TSWV infection of the inoculated cowpea plants was further confirmed by RT-PCR and sequential sequencing. Cowpea plants with similar symptoms were also observed in Yuxi City of Yunnan and one of the plants was confirmed infecting with TSWV by dot-ELISA and RT-PCR. Our results showed that TSWV

SUMMARY Co-infection of Carrot red leaf virus (CtRLV), Carrot mottle virus (CMoV) and Carrot red leaf virus associated RNA (CtRLVaRNA) causes Carrot motley dwarf (CMD) disease. This study examined the capacity of the aphid Myzus persicae at transmitting viruses associated with CMD. M. persicae exposed to CMD-infected chervil plants transmitted CtRLV-, CMoV-and CtRLVaRNA to disease-free chervil, fennel, celery, carrot, cilantro, and parsley, as shown by RT-PCR using specific primers. Recipient plants developed typical CMD symptoms. Sequence analysis of the amplified virus genes showed high sequence diversity with corresponding sequences available in GenBank. This study expands on Cavariella aegopodii, the only previously recognized aphid vector of CMD-causing viruses.

Potato virus Y (PVY, genus Potyvirus, family Potyviridae) is transmitted nonpersistently by aphids. It causes major losses in potato production (Solanum tuberosum), especially following seed tuber-borne infection of plants. To limit the risk of PVY infection, seed potato production is located preferably in regions where vector pressure is low. The northern-most high-grade seed potato production area (HG zone) of Europe is in Finland. The aim of this study was to determine the incidence of aphid species with documented ability to transmit PVY and to use a modelling approach to determine their relative importance as vectors of PVY in the HG zone of Finland. Winged aphids were caught from six to seven potato fields in each of three growing seasons (2007-09) using yellow pan traps that were examined twice a week. Identification of more than 30 000 individuals indicated that 37% of the aphids belonged to nine species reported to transmit PVY. Incidence of PVY in seed lots was low (0-5.6%) and the seasonal increase of PVY incidence was also low in the potato crops. No potato-colonising aphids were found on the plants in any of the years. The seasonal increase in PVY incidence was modelled using aphid counts in traps, the relative vector efficiencies of the aphids, virus resistance of cultivars, and the initial infection rate of the seed tubers as explanatory variables in generalised linear mixed modelling. Akaike's information criterion was employed to find the best set of explanatory variables for PVY in harvested tubers. Results of this modelling approach showed that the incidence of seedborne PVY infection and the early-season vector flights are the most important factors contributing to the incidence of PVY in the yield. Compared to models with data from all potential vector species, models containing data from Aphis fabae only showed a better model fit with regard to the incidence of PVY in the harvested tubers. The explanatory power of the models was lost when A. fabae was omitted from the vector data, suggesting that other species play a negligible role as vectors of PVY in the HG zone of Finland. Results can be used to devise appropriate strategies for enhanced control of PVY.

Aphid flight activities in seed potato fields have been studied by the yellow water traps. It is a good method for monitoring aphids as vectors of viruses, but this study also showed it is a suitable method for insectdiversity research. During the four-year studies, over 11.500 specimens were collected and a total of 107 different taxa of aphids were identified. The most abundant species were polyphagous species, such as: Acyrthosiphon pisum (Haris), Aphis fabae Scopoli, Aphis gossypii Glover and Brachycaudus helichrysi (Kaltenbach). The results of the studies show that diversity of aphids in different regions of Serbia is similar regardless of the altitude and the diversity of terrain. At most sites it ranged from 2 to 3. The highest value was recorded in Begeč, locality in northern part of Serbia, in year 2008, and it was 2.92. The maximum values of the Shannon-Weaver diversity index at all sites were recorded in the first weeks of the monitoring of aphid flight activities. Morisita-Horn similarity index shows no significant differences between sites regardless of altitudes. The sites are grouped by year, not by similarity of relief. In spite of these results, the Chi-square analysis showed highly significant difference in vector frequencies among seasons and sites with more pronounced differences for PVY. As a consequence of differences in vector frequencies, the vector pressure index in some regions was different also. The number of vectors and vector pressure index vary depending on the altitude of localities. At localities at altitudes under 1000 m, they were high. The highest index was at Kotraža, locality in central part of Serbia, in 2007, when PVY index exceeded the value of 180, while for PLRV it was 60. At high altitudes on mountain Golija, above 1100 m, the number of aphids was low, as well as the vector pressure index which indicates that these regions are suitable for producing virus-free seed potato.

The nuclcoiidc scqucncc of the cout protcin (CP) gene and the 3' non-translatcd region, in relation to aphid transmission of 7 potato tuber nccroiic ringspot isolales of Potato vitus Y (PVyNTN) were studied. Five isolales originatcd from diffcrcnt areas of potato ficlds in Hungary and two German isola tes servcd as controls. A 5' tail of the nuclcotidc sequences of the CP region and 3' non-rranslatcd region (NTR) were dcter-mincd. Scqucncc dala wcrc scm to the EMBL GeneBank Database. Hornelegy of nuclcotide and amino acid scqucnccs wcrc high among the studied PVY isolates. Aceording to the charactcristic rcgions, ali isolales belenged to thc PVyNT strain. Ali of the lested isolales could be transmiucd by the aphid Myzus persicae Sulzer to the test plant Nicotiana tabaCIIIII L. verifying the wide distribution oftuber necrene ringspot sirain in Hungary. Our data suggest that the high bomology found in the CP region of the differcru isolates. arc suitablc for development of coat protein mediated rosistanec against PVY in commercially importunt host plants like, e.g. potato.

First report of a pathogenic virus in citrus aphids, and its subsequent transovarial transmission. Aphids are important horticultural pests which have few biological control agents available for use in their management. A known entomopathogenic virus, insect iridescent virus 6 (IIV6), was
evaluated for pathogenicity to the brown citrus aphid, Toxoptera citricida (Kirkaldy). The virus, an Iridovirus, is a dsDNA virus, with an icosahedral symmetry and is ~120 nm in diameter. Although invertebrate iridescent iridoviruses are known to infect insects, this is the first report of an iridovirus infection in citrus aphids that is pathogenic. Modes of transmission for iridoviruses in other insect systems have been shown to be through oral ingestion and cuticular wounding. We demonstrated virus acquisition by aphids through oral ingestion via artificial membrane feeding experiments, and show the first evidence of vertical, transovarial transmission of an iridovirus, as confirmed by PCR analysis of virus-infected nymphs. Virus fed aphids had a decrease in longevity and reduced fecundity over control aphids. At 19 d post-treatment, the control aphid population had a 30% mortality rate, while the virus-fed aphid adults had a 68.3% mortality rate. Virus-fed aphids had a lower fecundity rate, producing on average 1.6 nymphs per day, while control aphids produced an average of 3 nymphs per day. Entomopathogenic viruses in aphids need to be re-examined for use in developing molecular tools and for their potential as biological control agents.

Potato virus Y (PVY, genus Potyvirus, family Potyviridae) is transmitted nonpersistently by aphids. It causes major losses in potato production (Solanum tuberosum), especially following seed tuber-borne infection of plants. To limit the risk of PVY infection, seed potato production is located preferably in regions where vector pressure is low. The northern-most high-grade seed potato production area (HG zone) of Europe is in Finland. The aim of this study was to determine the incidence of aphid species with documented ability to transmit PVY and to use a modelling approach to determine their relative importance as vectors of PVY in the HG zone of Finland. Winged aphids were caught from six to seven potato fields in each of three growing seasons (2007-09) using yellow pan traps that were examined twice a week. Identification of more than 30 000 individuals indicated that 37% of the aphids belonged to nine species reported to transmit PVY. Incidence of PVY in seed lots was low (0-5.6%) and the seasonal increase of PVY incidence was also low in the potato crops. No potato-colonising aphids were found on the plants in any of the years. The seasonal increase in PVY incidence was modelled using aphid counts in traps, the relative vector efficiencies of the aphids, virus resistance of cultivars, and the initial infection rate of the seed tubers as explanatory variables in generalised linear mixed modelling. Akaike's information criterion was employed to find the best set of explanatory variables for PVY in harvested tubers. Results of this modelling approach showed that the incidence of seedborne PVY infection and the early-season vector flights are the most important factors contributing to the incidence of PVY in the yield. Compared to models with data from all potential vector species, models containing data from Aphis fabae only showed a better model fit with regard to the incidence of PVY in the harvested tubers. The explanatory power of the models was lost when A. fabae was omitted from the vector data, suggesting that other species play a negligible role as vectors of PVY in the HG zone of Finland. Results can be used to devise appropriate strategies for enhanced control of PVY.

The study aimed to investigate the vectorial capacity of twelve insect species to transmit Rice Yellow Mottle Virus (RYMV) from diseased seedlings of a susceptible rice variety (Bouaké 189) and a perennial wild rice (Oryza longistaminata) to seven alternative host plants. Results indicated that Trichispa sericea, Chaetocnema pulla, Chnootriba similis, Conocephalus longipennis, Oxya hyla, Paratettix sp., Zonocerus variegatus, Euscyrtus sp., Cofana spectra, Cofana unimaculata, Locris rubra and Locris maculata were capable of transmitting RYMV from infected Bouaké 189 and Oryza longistaminata to alternative weed hosts Leersia hexandra, Imperata cylindrica, Digitaria horizontalis, Echinochloa colona, Echinocloa crus-pavonis, Eleusine indica and Brachiaria lata. Only Chaetocnema pulla, Trichispa sericea, Chnootriba similis, Oxya hyla, Zonocerus variegatus, Euscyrtus sp., Parattetix sp., Cofana spectra, Cofana unimaculata and Locris rubra played an important role in transmitting the disease from rice to O. longistaminata, Leersia hexandra and Imperata cylindrica. The present study confirmed the vectorial capacity of these vectors out of which eight were reported for the first time in West Africa.

In the context of an epidemiological study on Potato virus Y (PVY) in potato crops, Solanum elaeagnifolium Cav. was included in the weeds prospected. Surveys were carried out in four seed potato areas: Cap Bon, Manouba, Jendouba and Kairouan. S. elaeagnifolium was found in all areas, except Cap Bon. Virus-like symptoms were observed on some S. elaeagnifolium plants in the field, i.e. leaf mottling and curling. Aphids were collected on these plants and were identified as Myzus persicae and Aphis fabae, both known to colonize potatoes and to transmit the standard PVYN isolate with transmission efficiencies of 95% and 43%, respectively. Forty-seven plant samples were tested with ELISA for the presence of PVY. Positive reactions were obtained from 2/6, 5/18, 8/23 samples collected in Manouba, Jendouba and Kairouan, respectively. Virus transmission was carried out using M. persicae as vector from two samples of each region onto plantlets of Nicotiana tabacum cv Xanthi. All inoculated plantlets displayed typical symptoms of the PVYN strain group, confirmed by serological testing using specific antibodies. This is the first report of a PVY natural infection on S. elaeagnifolium in Tunisia. The abundance of this weed, its over-wintering status and the high rate of PVY-infected plants (31.9%) allow us to deduce that S. elaeagnifolium must be considered a reservoir species of PVY under natural conditions in Tunisia and probably in other Mediterranean countries. The presence of efficient aphid vectors of PVY on this weed in crops is additional evidence that S. elaeagnifolium may become a problem by acting as a source plant for PVY spread in potato crops.