Academia.eduAcademia.edu

Figure 5 – uploaded by Hiroshi Hori

See full PDFdownloadDownload figure
Figure 1 7rap220 ~'~ MEFs have defects in PPARy2-stimulated adipogenesis. Cells infected with either a control retroviral vector (oMSCVpuro) or one expressing PPARy2 (pMSCV-PPARy2) were induced with differentiation medium in the presence or absence of 0.5 pM synthetic PPARy ligand rosiglitazone. At day 8 post-induction, cells were either stained for lipid droplets with Oil Red O or total RNA was extracted and subjected to northern blot. a, Morphological differentiation shown by Oil Red 0 staining. b, Northern blot analysis of gene expression pattern. KO, 7rap220~'~ cells; WT, wild-type cells. PPARy is a key regulator of transcriptional pathways important for adipogenesis*. Retrovirus vector-mediated ectopic expression of PPARy2 alone can stimulate mouse embryonic fibroblasts (MEFs) to undergo adipogenesis”’®. PPARy is a member of the nuclear hormone receptor superfamily of DNA binding transcriptional activators that, in a ligand-dependent manner, activate specific target genes important for cell growth, cell differentiation and homeostasis. Like other transcriptional activators, nuclear receptors act through a variety of interacting transcriptional coactivators that act either to modify chromatin structure or at subsequent steps such as preinitiation complex (PIC) assembly and function”’’. The mammalian TRAP complex, like the distantly related yeast Mediator, appears to play the main role in direct communication between diverse activators and the general transcription factors that form the PIC*'*””. The demonstration of ligand-dependent inter- actions of the TRAP220 subunit of the TRAP complex with multiple nuclear receptors suggested a broad role for TRAP in nuclear receptor function and associated physiological processes*. As the TRAP220 subunit of the TRAP complex has been shown to interact physically with PPARy2*", we sought to investigate the physiologi- cal role of TRAP220, and the possible involvement of the entire TRAP complex, in PPARy2-stimulated adipogenesis and target

Figure 1 7rap220 ~'~ MEFs have defects in PPARy2-stimulated adipogenesis. Cells infected with either a control retroviral vector (oMSCVpuro) or one expressing PPARy2 (pMSCV-PPARy2) were induced with differentiation medium in the presence or absence of 0.5 pM synthetic PPARy ligand rosiglitazone. At day 8 post-induction, cells were either stained for lipid droplets with Oil Red O or total RNA was extracted and subjected to northern blot. a, Morphological differentiation shown by Oil Red 0 staining. b, Northern blot analysis of gene expression pattern. KO, 7rap220~'~ cells; WT, wild-type cells. PPARy is a key regulator of transcriptional pathways important for adipogenesis*. Retrovirus vector-mediated ectopic expression of PPARy2 alone can stimulate mouse embryonic fibroblasts (MEFs) to undergo adipogenesis”’®. PPARy is a member of the nuclear hormone receptor superfamily of DNA binding transcriptional activators that, in a ligand-dependent manner, activate specific target genes important for cell growth, cell differentiation and homeostasis. Like other transcriptional activators, nuclear receptors act through a variety of interacting transcriptional coactivators that act either to modify chromatin structure or at subsequent steps such as preinitiation complex (PIC) assembly and function”’’. The mammalian TRAP complex, like the distantly related yeast Mediator, appears to play the main role in direct communication between diverse activators and the general transcription factors that form the PIC*'*””. The demonstration of ligand-dependent inter- actions of the TRAP220 subunit of the TRAP complex with multiple nuclear receptors suggested a broad role for TRAP in nuclear receptor function and associated physiological processes*. As the TRAP220 subunit of the TRAP complex has been shown to interact physically with PPARy2*", we sought to investigate the physiologi- cal role of TRAP220, and the possible involvement of the entire TRAP complex, in PPARy2-stimulated adipogenesis and target

Related Figures (6)

YY but absent in XX and XY. These results indicate that PG77 is specific to the Y chromosome but absent from the Y chromosome of XY. Specific primers for PG77 and 51H7.F were as follows: PG17:; PG17.19, GAACCACAGCTTGAAGACCCCGCTGA; PG17.20, GCATCTGCTGGTACTGCTGGTAGTTG; and 57H7.F: 51H7.F2, CAGGCCTTGAAGATCAACGAGT; 51H7.F3, AGTGCATCTAGTGTACATGGGT. c, Histological cross-sections of medaka fry sampled 30 d.a.h.. Sex chromosome types were determined by PCR using DNA extracted from the head. Black arrowheads indicate gonads. XX and XY ~ individuals have ovaries with several oocytes, whereas XY specimens have testes with spermatogonia. Scale bars, 50 ym. Figure 2 Characteristics of medaka lacking a part of the Y chromosome. a, Phenotypes o the congenic strain (XX, XY) and medaka lacking a part of the Y chromosome (XY). X) (top), XY~ and XY (bottom) with their secondary sex characters. Males (XY) have larger anal and dorsal fins than females (XX, XY"). XX have white bodies (X’x’), whereas the others are orange-red (x’Y"). b, DNA types (SL1PG17and 51H7.F) of sex chromosomes PCR products of SL7 and PG77 were electrophoresed in a 1% agarose gel with a 1-kk DNA ladder. A/ul-digested PCR products of 57H7.F were electrophoresed in a 3% agaros¢ gel with a 100-bp DNA ladder. SL7 and 57H7.F are homozygous in XX and YY (Hd-rR o HNI type), but are heterozygous in XY" and XY (Hd-rR/HNI type). PG77is present in XY anc Figure 1 Positional cloning strategy of the sex-determining region and subsequent identification of PG17/DMY. a, Genetic maps of the sex-determining regions and Y chromosomes of the recombinant strains. Pink indicates regions derived from an HNI Y chromosome; yellow represents Hd-rR X-chromosome-derived regions. b, BAC contigs and a physical map of the sex-determining region. Horizontal bars indicate BAC clones. Blue blocks show the sequenced regions. ¢, d, Cytogenetical mapping of the sex- determining region of medaka. ¢, FISH of metaphase chromosomes. SL2 (red) localizes on the short arms of the sex chromosomes, whereas a BAC clone containing SL7 (mCONO72N5, yellow) localizes on the long arms. Arrowheads indicate sex chromosomes. d, FISH of one sex chromosome with three different probes (SL2, SL7, SD). Signals of a BAC clone containing the sex-determining region (mCON049E13) are light blue. The arrowhead shows the centromere region. e, The Y chromosome of medaka lacking a part of the sex-determining region. DNA markers were not detected between
YY but absent in XX and XY. These results indicate that PG77 is specific to the Y chromosome but absent from the Y chromosome of XY. Specific primers for PG77 and 51H7.F were as follows: PG17:; PG17.19, GAACCACAGCTTGAAGACCCCGCTGA; PG17.20, GCATCTGCTGGTACTGCTGGTAGTTG; and 57H7.F: 51H7.F2, CAGGCCTTGAAGATCAACGAGT; 51H7.F3, AGTGCATCTAGTGTACATGGGT. c, Histological cross-sections of medaka fry sampled 30 d.a.h.. Sex chromosome types were determined by PCR using DNA extracted from the head. Black arrowheads indicate gonads. XX and XY ~ individuals have ovaries with several oocytes, whereas XY specimens have testes with spermatogonia. Scale bars, 50 ym. Figure 2 Characteristics of medaka lacking a part of the Y chromosome. a, Phenotypes o the congenic strain (XX, XY) and medaka lacking a part of the Y chromosome (XY). X) (top), XY~ and XY (bottom) with their secondary sex characters. Males (XY) have larger anal and dorsal fins than females (XX, XY"). XX have white bodies (X’x’), whereas the others are orange-red (x’Y"). b, DNA types (SL1PG17and 51H7.F) of sex chromosomes PCR products of SL7 and PG77 were electrophoresed in a 1% agarose gel with a 1-kk DNA ladder. A/ul-digested PCR products of 57H7.F were electrophoresed in a 3% agaros¢ gel with a 100-bp DNA ladder. SL7 and 57H7.F are homozygous in XX and YY (Hd-rR o HNI type), but are heterozygous in XY" and XY (Hd-rR/HNI type). PG77is present in XY anc Figure 1 Positional cloning strategy of the sex-determining region and subsequent identification of PG17/DMY. a, Genetic maps of the sex-determining regions and Y chromosomes of the recombinant strains. Pink indicates regions derived from an HNI Y chromosome; yellow represents Hd-rR X-chromosome-derived regions. b, BAC contigs and a physical map of the sex-determining region. Horizontal bars indicate BAC clones. Blue blocks show the sequenced regions. ¢, d, Cytogenetical mapping of the sex- determining region of medaka. ¢, FISH of metaphase chromosomes. SL2 (red) localizes on the short arms of the sex chromosomes, whereas a BAC clone containing SL7 (mCONO72N5, yellow) localizes on the long arms. Arrowheads indicate sex chromosomes. d, FISH of one sex chromosome with three different probes (SL2, SL7, SD). Signals of a BAC clone containing the sex-determining region (mCON049E13) are light blue. The arrowhead shows the centromere region. e, The Y chromosome of medaka lacking a part of the sex-determining region. DNA markers were not detected between
PG31C and A314482, but were detected on the centromere side of PGO4 and the telomere side of PG31T. Respective location of PG17, PG27 and PG30 within the sex- determining region between PGO4 and PG37T is shown. f, RT-PCR analysis for PG77, PG21 and PG30 mRNA expression in whole Hd-rR.Y™' embryos at hatching. Sex chromosome types were determined by SL7 PCR. PG77 expression was detected by nested PCR (see Methods). g, h, Structure and sequences of PG77/DMY. g, Structural analysis of the PG77/DMY showing exons (open boxes), the DM domain (grey boxes) and introns (horizontal lines) of PG77. Translation start and stop sites are indicated by ATG and STOP, respectively. Numbers represent nucleotide sequence length (base pairs, bp). h, Amino-acid sequence of wild-type PG17/DMT and the PG17"““" mutation. The DM domain is boxed. A frame shift (italicized) occurs in the region from amino acid 110 to premature termination (amino acid 139).
PG31C and A314482, but were detected on the centromere side of PGO4 and the telomere side of PG31T. Respective location of PG17, PG27 and PG30 within the sex- determining region between PGO4 and PG37T is shown. f, RT-PCR analysis for PG77, PG21 and PG30 mRNA expression in whole Hd-rR.Y™' embryos at hatching. Sex chromosome types were determined by SL7 PCR. PG77 expression was detected by nested PCR (see Methods). g, h, Structure and sequences of PG77/DMY. g, Structural analysis of the PG77/DMY showing exons (open boxes), the DM domain (grey boxes) and introns (horizontal lines) of PG77. Translation start and stop sites are indicated by ATG and STOP, respectively. Numbers represent nucleotide sequence length (base pairs, bp). h, Amino-acid sequence of wild-type PG17/DMT and the PG17"““" mutation. The DM domain is boxed. A frame shift (italicized) occurs in the region from amino acid 110 to premature termination (amino acid 139).
Ratios are from progeny of mutant female x Hd-rR male crosses. Sex chromosome type was determined from SL1 and PG17 genotypes. NA, not applicable (fry were not analysed). Table 1 Genotype and gonadal phenotype ratios
Ratios are from progeny of mutant female x Hd-rR male crosses. Sex chromosome type was determined from SL1 and PG17 genotypes. NA, not applicable (fry were not analysed). Table 1 Genotype and gonadal phenotype ratios
Figure 3 cDNA PCR of progeny from XY" and XY” female x Hd-rR male crosses. A PG17/DMY band was detected in XY" and XY" embryos but not in XY“S” embryos. Total RNA (150 ng each) was extracted from whole embryos (at hatching) and used for cDNA synthesis and amplification using the SMART PCR cDNA Synthesis Kit (Clontech) according to the manufacturer’s protocol. Amplified CDNA and genomic DNA were used as PCR templates of PG04 and PG17 (PG17.19—20 primer set). Specific primers for PGO4 were as follows: PGO4.1, CCAGCGGTTTGAGGATAGGTTTG; PG04.2, GAGCTTTCTGCAGGGCGACTTTC. Products were electrophoresed in a 2% agarose gel with a 100-bp DNA ladder.
Figure 3 cDNA PCR of progeny from XY" and XY” female x Hd-rR male crosses. A PG17/DMY band was detected in XY" and XY" embryos but not in XY“S” embryos. Total RNA (150 ng each) was extracted from whole embryos (at hatching) and used for cDNA synthesis and amplification using the SMART PCR cDNA Synthesis Kit (Clontech) according to the manufacturer’s protocol. Amplified CDNA and genomic DNA were used as PCR templates of PG04 and PG17 (PG17.19—20 primer set). Specific primers for PGO4 were as follows: PGO4.1, CCAGCGGTTTGAGGATAGGTTTG; PG04.2, GAGCTTTCTGCAGGGCGACTTTC. Products were electrophoresed in a 2% agarose gel with a 100-bp DNA ladder.
Figure 4 PG77/DMY mRNA expression in fry gonads shown by digoxigenin-labelled in situ hybridization of larval sections. a, XY gonads on hatching day; antisense probe. Strong signals for PG17/DMY were seen in cells surrounding the germ cells. G, germ cell; CE, coelomic epithelium; ND, nephric duct. b, XX gonad on hatching day; antisense probe. PG17/DMY signal was undetectable in XX individuals. ¢, XY gonad on hatching day; sense probe. Control hybridization showed no signal. Scale bar, 20 um.
Figure 4 PG77/DMY mRNA expression in fry gonads shown by digoxigenin-labelled in situ hybridization of larval sections. a, XY gonads on hatching day; antisense probe. Strong signals for PG17/DMY were seen in cells surrounding the germ cells. G, germ cell; CE, coelomic epithelium; ND, nephric duct. b, XX gonad on hatching day; antisense probe. PG17/DMY signal was undetectable in XX individuals. ¢, XY gonad on hatching day; sense probe. Control hybridization showed no signal. Scale bar, 20 um.
Published online 12 May 2002, DOI 10.1038/nature751.
Published online 12 May 2002, DOI 10.1038/nature751.
Related topics:
Y chromosomeSex DeterminationPhysical chromosome mappingSexual Differentiation
580 California St., Suite 400
San Francisco, CA, 94104
© 2025 Academia. All rights reserved